---
title: "On DNA and its marvellous mistakes"
date: "2020-10-05T12:00:28+01:00"
modified: "2020-10-05T12:00:28+01:00"
url: "https://newhumanist.org.uk/articles/on-dna-and-its-marvellous-mistakes/"
post_id: 7077
---

# On DNA and its marvellous mistakes

*![Zayapa__Grapsus_grapsus_,_Las_Bachas,_isla_Santa_Cruz,_islas_Galápagos,_Ecuador,_2015-07-23,_DD_30](https://newhumanist.org.uk/wp-content/uploads/sites/2/images/Zayapa__Grapsus_grapsus_,_Las_Bachas,_isla_Santa_Cruz,_islas_Galápagos,_Ecuador,_2015-07-23,_DD_30.jpg "'Grapsus grapsus' was collected by Charles Darwin on his HMS Beagle voyage")*

*From the [autumn 2020 edition](From%20the%20autumn%202020%20edition%20of%20New%20Humanist.) of New Humanist.*

You are a third mushroom. That’s right. You, me, all of us, share a third of our DNA with fungi. It is strong evidence that humans and mushrooms – in fact, all creatures that share the Earth today – have a common ancestor, a fact first recognised by Charles Darwin.

In 1831, aged just 22, Darwin took up the post of ship’s naturalist on HMS *Beagle*. During its five-year voyage, he made a series of striking zoological observations. He noticed, for instance, that the birds and animals on the isolated Galápagos Islands, 1000 kilometres off the west coast of South America, appeared to be variants of a small subset of birds and animals found on the continent. Not only that, but the birds and animals on each island differed from each other in subtle ways. Most famously, the finches on islands where large nuts were available had stubbier beaks than those living elsewhere on the archipelago.

After 18 months of intense concentration, a light went on in Darwin’s mind. He realised why creatures were so exquisitely tailored for their environments. And it was not, as was the prevailing view, that they had been “designed” by a Creator. There was a perfectly natural mechanism that created the “illusion of design”.

Most creatures, Darwin recognised, produced many more offspring than could be supported by the available food. However, in the struggle for survival, those best suited to exploit the resources of their environment persisted, whereas those least suited perished. The casualties were staggeringly huge. But, by this process of “natural selection”, creatures changed incrementally, generation by generation, to be better adapted to their environments.

Darwin reasoned that, millions of years before, when the volcanic Galápagos Islands had risen from the sea, a handful of creatures – birds that had flown and other animals that had been driven by storms across the ocean on mats of vegetation – had reached the archipelago from the mainland of South America. Finding an essentially empty world, they had spread out to fill all the available ecological niches. Darwin’s finches, isolated on different islands, had suffered the pressure of natural selection; the least adapted for survival had been culled while the best adapted prevailed. In the case of an island with large nuts, inevitably the finches that survived were those with stubby beaks.

Darwin’s courage was to present his theory of evolution by natural selection without knowing two key things: first, how characteristics were passed on, or “inherited”, from generation to generation; and, secondly, what created the variation in offspring – the raw material for natural selection to work on. We now know that these two things are intimately connected. The “blueprint” for an organism is recorded in the large biological molecule called deoxyribonucleic acid, or DNA, which is carried in every cell. It is “mutations” in DNA, often caused in the copying process when cells reproduce, that give rise to varied and novel traits in offspring. “The capacity to blunder slightly is the real marvel of DNA,” said the American biologist Lewis Thomas. “Without this special attribute, we would still be anaerobic bacteria and there would be no music.”

According to Darwin, all creatures on Earth today have evolved by a process of natural selection from a simple common ancestral organism. This, ultimately, is the reason why we share a third of our DNA with mushrooms.

In fact, the following stretch of DNA is present in every cell of every creature on Earth, including every one of the 100 trillion cells in your body: GTGCCAGCAGCCGCGGTAATTCCAGCT CCAATAGCGTATATTAAAGTTGCTGCA GTTAAAAAG \[G = Guanine; T = Thymine; A = Adenine; C = Cytosine\]. Can there be a more striking piece of evidence that all creatures are related and that they evolved from a common ancestor, exactly as Darwin claimed? In the words of Thomas: “All of today’s DNA, strung through all the cells of the Earth, is simply an extension and elaboration of the first molecule.”

Darwin knew that the process of evolution by natural selection was painfully slow and would have required hundreds of millions, if not billions, of years to create the profusion of life on Earth today. The first tentative evidence of life on our planet dates to about 3.8 billion years ago. Conceivably, the first cell – dubbed the last universal common ancestor – arose around 4 billion years ago, a mere half a billion years after the birth of the Earth. Exactly how this happened, and how the step from non-life to life was taken, remains one of the biggest unanswered questions in science.